Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
Hsa_circ_0102533 | |||
Gene | PCNX | Organism | Human |
Genome Locus | chr14:71502781-71522279:n/a | Build | hg19 |
Disease | Non small cell Lung Cancer | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
DBLink | Link to database | PMID | http://www.ijcep.com/files/ijcep0077672.pdf |
Experimental Method | |||
Sample Type | Tissues, Whole blood samples and Cell lines | Comparison | Forty-one NSCLC patients and twenty-six healthy subjects |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CCGACCTGTGAAATTCTGGGA ReverseGCAGGCTGCAATACTGTGAAG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
http://www.ijcep.com/files/ijcep0077672.pdf |